fossilesque@mander.xyzM to Science Memes@mander.xyzEnglish · 14 hours agooriginalitymander.xyzexternal-linkmessage-square48fedilinkarrow-up1462arrow-down19
arrow-up1453arrow-down1external-linkoriginalitymander.xyzfossilesque@mander.xyzM to Science Memes@mander.xyzEnglish · 14 hours agomessage-square48fedilink
minus-squarekautau@lemmy.worldlinkfedilinkEnglisharrow-up11·10 hours agoMaybe at some point we’ll have version control for all DNA mapping so each minor change is a commit hash and each major release is a tag
minus-squaretetris11@lemmy.mllinkfedilinkEnglisharrow-up3·edit-23 hours agoWe do, the major versions have tag releases like mm7, mm8, mm9, etc. as defined by the current build, and minor patch releases too like mm10p14 as new sequences come in. https://hgdownload.cse.ucsc.edu/goldenpath/mm10/bigZips/ Example, say you have 5 sequences: CAT, ATC, ATCG, CGT, and ATATA. One way of combining them up together to build a transcriptome is like this: 5 sequences: ATATA CG-T ATC ATCG CAT Reference: ATCGATATATC ATCGATATATC isn’t the only solution to these sequences, but as you get more sequences to try and overlap, the more the uncertainty goes down
Maybe at some point we’ll have version control for all DNA mapping so each minor change is a commit hash and each major release is a tag
We do, the major versions have tag releases like mm7, mm8, mm9, etc. as defined by the current build, and minor patch releases too like mm10p14 as new sequences come in.
https://hgdownload.cse.ucsc.edu/goldenpath/mm10/bigZips/
Example, say you have 5 sequences: CAT, ATC, ATCG, CGT, and ATATA.
One way of combining them up together to build a transcriptome is like this:
5 sequences: ATATA CG-T ATC ATCG CAT Reference: ATCGATATATCATCGATATATC isn’t the only solution to these sequences, but as you get more sequences to try and overlap, the more the uncertainty goes down